shRNA Lentivirus (self-inactivating), pU6-(4921504E06Rik-shRNA-Seq3)(CAT#: LV-SI1820WQ)

This product is a 4921504E06Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 4921504E06Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 4921504E06Rik-shRNA-Seq3
Related Target/Protein 4921504E06Rik
Region 3UTR
TargetSeq CGACCTCTTTGGATATCCCAA
NCBI RefSeq NM_027600
Titer >1*10^10 GC/mL
Target Gene
Gene ID 70909
Uniprot ID Q8CET2

Related Products