shRNA Adeno-associated Virus Serotype 2, p7SK-(TMEM177-shRNA-Seq1)(CAT#: AAV-SI3504WQ)
This product is a TMEM177-shRNA encoding AAV, which is based on AAV-2 serotype. The preotien encoded by TMEM177 gene plays a role in the early steps of cytochrome c oxidase subunit II (MT-CO2/COX2) maturation. The expression of TMEM177-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TMEM177-shRNA-Seq1 |
Related Target/Protein | TMEM177 |
Region | CDS |
TargetSeq | CAGACACTTGTTCCGAATCAA |
NCBI RefSeq | NM_030577 |
Titer | >1*10^10 GC/mL |