shRNA Adeno-associated Virus Serotype 2, pU6-(BC003266-shRNA-Seq1)(CAT#: AAV-SI2298WQ)

This product is a Smim12-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Smim12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert BC003266-shRNA-Seq1
Related Target/Protein BC003266
Region 3UTR
TargetSeq CCTGTGTGCATTCTTCCCTTT
NCBI RefSeq NM_030252
Alternative Names Smim12
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80284
Uniprot ID Q78RX3

Related Products