shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(CCT3-shRNA-Seq1)(CAT#: AdV-SI3802WQ)
This product is a CCT3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by CCT3 gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). The expression of CCT3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | CCT3-shRNA-Seq1 |
Related Target/Protein | CCT3 |
Region | CDS |
TargetSeq | GACATCGTTTCAGGCCACAAA |
NCBI RefSeq | NM_005998 |
Alternative Names | CCTG; PIG48; TRIC5; CCT-gamma; TCP-1-gamma |
Titer | >1*10^10 GC/mL |