shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(FAM70A-shRNA-Seq1)(CAT#: AdV-SI1153WQ)
This product is a FAM70A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. TMEM255A is often referred to as family with sequence similarity 70, member A (FAM70A). The TMEM255A protein is transmembrane and is predicted to be located the nuclear envelope of eukaryote organisms. The expression of FAM70A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | FAM70A-shRNA-Seq1 |
Related Target/Protein | FAM70A |
Region | CDS |
TargetSeq | CCATCTATGTCACCGTGACTT |
NCBI RefSeq | NM_017938 |
Alternative Names | Tmem255a; 4933417N17; 6430550H21Rik |
Titer | >1*10^10 GC/mL |
Related Diseases | Glioblastoma multiforme |