shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SESN1-shRNA-Seq1)(CAT#: AdV-SI3459WQ)
This product is a SESN1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by SESN1 gene is a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The expression of SESN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | SESN1-shRNA-Seq1 |
Related Target/Protein | SESN1 |
Region | 3UTR |
TargetSeq | GCAAAGAATGGGACTTGGATA |
NCBI RefSeq | NM_014454 |
Alternative Names | PA26; SEST1 |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA damage |