shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(VARS2-shRNA-Seq3)(CAT#: AdV-SI3235WQ)
This product is a VARS2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The VARS2 encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. The expression of VARS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | VARS2-shRNA-Seq3 |
Related Target/Protein | VARS2 |
Region | 3UTR |
TargetSeq | GTCTTTGAGGACAAACAGATT |
NCBI RefSeq | NM_020442 |
Alternative Names | VALRS; VARSL; VARS2L; COXPD20 |
Titer | >1*10^10 GC/mL |
Related Diseases | oxidative phosphorylation deficiency-20 |