shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C16orf62-shRNA-Seq2)(CAT#: AdV-SI0987WQ)

This product is a C16orf62-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C16orf62 gene acts as component of the retriever complex. The expression of C16orf62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C16orf62-shRNA-Seq2
Related Target/Protein C16orf62
Region CDS
TargetSeq GATAGAGATGATAACTCCGTT
NCBI RefSeq NM_020314
Alternative Names VPS35L
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 57020
Uniprot ID Q7Z3J2

Related Products