shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(KIAA0495-shRNA-Seq1)(CAT#: AdV-SI0926WQ)
This product is a KIAA0495-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of KIAA0495-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | KIAA0495-shRNA-Seq1 |
Related Target/Protein | KIAA0495 |
Region | CDS |
TargetSeq | CAAGTAAAGATACCAGCAGTG |
NCBI RefSeq | NM_207306 |
Alternative Names | PDAM; TP73-AS1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Oligodendroglial tumors |
Target Gene | |
---|---|
Gene ID | 57212 |
Uniprot ID | A0A024R4G0 |