shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Lamtor2-shRNA-Seq1)(CAT#: AdV-SI3196WQ)
This product is a Lamtor2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Lamtor2 gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The expression of Lamtor2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Lamtor2-shRNA-Seq1 |
Related Target/Protein | Lamtor2 |
Region | CDS |
TargetSeq | GCTGAATAATGAGGGATCGCT |
NCBI RefSeq | NM_031248 |
Alternative Names | p14; ENDAP; ROBLD3; HSPC003; MAPBPIP; MAPKSP1AP; Ragulator2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Primary immunodeficiency syndrome |