shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Mvp-shRNA-Seq1)(CAT#: AdV-SI3180WQ)
This product is a Mvp-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Mvp gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The expression of Mvp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Mvp-shRNA-Seq1 |
| Related Target/Protein | Mvp |
| Region | CDS |
| TargetSeq | GTGGAAGTCGTGGAGATCATT |
| NCBI RefSeq | NM_080638 |
| Alternative Names | LRP; VAULT1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |
