shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Obfc1-shRNA-Seq1)(CAT#: AdV-SI3200WQ)
This product is a Obfc1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Obfc1 gene appears to function in a telomere-associated complex with C17ORF68 and TEN1. The expression of Obfc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Obfc1-shRNA-Seq1 |
Related Target/Protein | Obfc1 |
Region | CDS |
TargetSeq | GCAGCAGAAGATCTACCACAT |
NCBI RefSeq | NM_175360 |
Alternative Names | AAF44; OBFC1; AAF-44; RPA-32; bA541N10.2; STN1 |
Titer | >1*10^10 GC/mL |