shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(OR8J3-shRNA-Seq3)(CAT#: AdV-SI2962WQ)

This product is a OR8J3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The OR8J3 gene encodes an odorant receptor. The expression of OR8J3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert OR8J3-shRNA-Seq3
Related Target/Protein OR8J3
Region CDS
TargetSeq CACCTCTGTTAGCATTATCTT
NCBI RefSeq NM_001004064
Alternative Names OR11-173
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 81168
Uniprot ID Q8NGG0

Related Products