shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(9330180L21Rik-shRNA-Seq1)(CAT#: AdV-SI2295WQ)
This product is a 9330180L21Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by 9330180L21Rik gene is part of various corepressor complexes mediates the recruitment of corepressor complexes to target genes, followed by chromatin compaction and repression of transcription. The expression of 9330180L21Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | 9330180L21Rik-shRNA-Seq1 |
| Related Target/Protein | 9330180L21Rik |
| Region | CDS |
| TargetSeq | CTACCTATTGACCTGGAGTTT |
| NCBI RefSeq | NM_175254 |
| Alternative Names | Smr; Sfmbt; AA536974; 4930442N21Rik; Sfmbt1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |
