shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C22orf39-shRNA-Seq1)(CAT#: AdV-SI0407WQ)

This product is a C22orf39-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The absence of the C22orf39 gene may be critical for inducing tumorigenesis. The expression of C22orf39-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C22orf39-shRNA-Seq1
Related Target/Protein C22orf39
Region 3UTR
TargetSeq GCGATGTTCTGCAGGACAATT
NCBI RefSeq NM_173793
Titer >1*10^10 GC/mL
Related Diseases Liver cancer
Target Gene
Gene ID 128977
Uniprot ID Q6P5X5

Related Products