shRNA Lentivirus (self-inactivating), pH1-(C7orf64-shRNA-Seq2)(CAT#: LV-SI0825WQ)
This product is a C7orf64-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C7orf64-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C7orf64-shRNA-Seq2 |
Related Target/Protein | C7orf64 |
Region | CDS |
TargetSeq | CGGCATAAACTTAAAGAGGTA |
NCBI RefSeq | NM_032120 |
Alternative Names | RBM48; HSPC304 |
Titer | >1*10^10 GC/mL |