shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Gsdma3-shRNA-Seq1)(CAT#: AdV-SI4029WQ)

This product is a Gsdma3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Gsdma3 gene may play a role in the transition from catagen to telogen at the end of hair follicle morphogenesis. The expression of Gsdma3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Gsdma3-shRNA-Seq1
Related Target/Protein Gsdma3
Region CDS
TargetSeq GCTCTGACAGAGCTAACTGAA
NCBI RefSeq NM_001007461
Alternative Names Bsk; Dfl; Fgn; Rco2; Rim3; Gsdm3; Gsdm1l
Titer >1*10^10 GC/mL
Target Gene
Gene ID 450219
Uniprot ID Q5Y4Y6

Related Products