shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Gvin1-shRNA-Seq3)(CAT#: AdV-SI3455WQ)
This product is a Gvin1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Gvin1 gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The expression of Gvin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Gvin1-shRNA-Seq3 |
Related Target/Protein | Gvin1 |
Region | CDS |
TargetSeq | GATCTTACCAGGCAATATATT |
NCBI RefSeq | NM_029000 |
Alternative Names | GVIN1; VLIG1; GVIN1P; VLIG-1; GVINP1 |
Titer | >1*10^10 GC/mL |