shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C21orf93-shRNA-Seq2)(CAT#: AdV-SI1256WQ)

This product is a C21orf93-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C21orf93-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C21orf93-shRNA-Seq2
Related Target/Protein C21orf93
Region 3UTR
TargetSeq CCTTCTCCTATCCGGAAAGTA
NCBI RefSeq NM_145179
Alternative Names NCRNA00315; LINC00315
Titer >1*10^10 GC/mL
Target Gene
Gene ID 246704
Uniprot ID P59091

Related Products