shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SDHAF2-shRNA-Seq1)(CAT#: AdV-SI0978WQ)
This product is a SDHAF2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SDHAF2 gene encodes a mitochondrial protein needed for the flavination of a succinate dehydrogenase complex subunit required for activity of the complex. The expression of SDHAF2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | SDHAF2-shRNA-Seq1 |
Related Target/Protein | SDHAF2 |
Region | CDS |
TargetSeq | GATATTTACTACTGGGCCACA |
NCBI RefSeq | NM_017841 |
Alternative Names | PGL2; SDH5; C11orf79 |
Titer | >1*10^10 GC/mL |
Related Diseases | Paraganglioma |