shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SFTA2-shRNA-Seq1)(CAT#: AdV-SI0578WQ)

This product is a SFTA2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by SFTA2 is a novel secretory peptide highly expressed in the lung. The expression of SFTA2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SFTA2-shRNA-Seq1
Related Target/Protein SFTA2
Region CDS
TargetSeq CGGGTATGACTTTGCAACTGA
NCBI RefSeq NM_205854
Alternative Names SP-G; SFTPG; UNQ541; GSGL541
Titer >1*10^10 GC/mL
Related Diseases Lung cancer
Target Gene
Gene ID 389376
Uniprot ID Q6UW10

Related Products