shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(CIAPIN1-shRNA-Seq1)(CAT#: AdV-SI0274WQ)
This product is a CIAPIN1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 or CASP families. The expression of CIAPIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | CIAPIN1-shRNA-Seq1 |
Related Target/Protein | CIAPIN1 |
Region | 3UTR |
TargetSeq | GAGTTGTTAGTTTACTCCATT |
NCBI RefSeq | NM_020313 |
Alternative Names | DRE2; CIAE2; PRO0915; Anamorsin |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular Carcinoma |