shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Hsph1-shRNA-Seq2)(CAT#: AdV-SI1966WQ)
This product is a Hsph1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Hsph1 gene encodes a member of the heat shock protein 70 family of proteins and functions as a nucleotide exchange factor for the molecular chaperone heat shock cognate 71 kDa protein (Hsc70). The expression of Hsph1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Hsph1-shRNA-Seq2 |
Related Target/Protein | Hsph1 |
Region | CDS |
TargetSeq | CGGCTGTTGCTTTGAATTATG |
NCBI RefSeq | NM_013559 |
Alternative Names | HSP105; HSP105A; HSP105B; NY-CO-25 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |