shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Zc3hav1l-shRNA-Seq4)(CAT#: AdV-SI2720WQ)
This product is a Zc3hav1l-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Zc3hav1l-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Zc3hav1l-shRNA-Seq4 |
| Related Target/Protein | Zc3hav1l |
| Region | 3UTR |
| TargetSeq | CCCTCTGTGCTGTCATCAATA |
| NCBI RefSeq | NM_172467 |
| Alternative Names | C7orf39 |
| Titer | >1*10^10 GC/mL |
