shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Trmt1-shRNA-Seq5)(CAT#: AdV-SI2007WQ)
This product is a Trmt1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Trmt1 gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The expression of Trmt1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Trmt1-shRNA-Seq5 |
Related Target/Protein | Trmt1 |
Region | CDS |
TargetSeq | GTCTGAAAGCAGTCCAGCATT |
NCBI RefSeq | NM_198020 |
Alternative Names | TRM1; MRT68 |
Titer | >1*10^10 GC/mL |
Related Diseases | Autosomal recessive intellectual disorder (ARID) |