shRNA Lentivirus (self-inactivating), p7SK-(9130011J15Rik-shRNA-Seq3)(CAT#: LV-SI3417WQ)

This product is a 9130011J15Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 9130011J15Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 9130011J15Rik-shRNA-Seq3
Related Target/Protein 9130011J15Rik
Region 3UTR
TargetSeq GATATGGAGTTTCAGTTAAAT
NCBI RefSeq NM_172396
Alternative Names Smim7
Titer >1*10^10 GC/mL
Target Gene
Gene ID 66818
Uniprot ID F8WIU9

Related Products