shRNA Lentivirus (self-inactivating), p7SK-(TREH-shRNA-Seq2)(CAT#: LV-SI1372WQ)
This product is a TREH-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TREH gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. The expression of TREH-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TREH-shRNA-Seq2 |
| Related Target/Protein | TREH |
| Region | CDS |
| TargetSeq | CCTGACTTACCAGTATGGGAT |
| NCBI RefSeq | NM_007180 |
| Alternative Names | TRE; TREA; TREHD |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Motoneuron degeneration |
