shRNA Lentivirus (self-inactivating), p7SK-(CEP170L-shRNA-Seq2)(CAT#: LV-SI1426WQ)

This product is a CEP170L-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of CEP170L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CEP170L-shRNA-Seq2
Related Target/Protein CEP170L
Region CDS
TargetSeq GCTGAATTTGAGAATGCTGAA
NCBI RefSeq NM_153243
Alternative Names FAM68B; CEP170L; KIAA0470L
Titer >1*10^10 GC/mL
Target Gene
Gene ID 645455
Uniprot ID Q96L14

Related Products