shRNA Lentivirus (self-inactivating), pU6-(Nkd1-shRNA-Seq1)(CAT#: LV-SI2333WQ)
This product is a Nkd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Nkd1 gene may activate a second Wnt signaling pathway that controls planar cell polarity. The expression of Nkd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Nkd1-shRNA-Seq1 |
Related Target/Protein | Nkd1 |
Region | CDS |
TargetSeq | CACCATTACCACCACTTCTAT |
NCBI RefSeq | NM_027280 |
Alternative Names | Naked1 |
Titer | >1*10^10 GC/mL |