shRNA Lentivirus (self-inactivating), pU6-(Nkd1-shRNA-Seq1)(CAT#: LV-SI2333WQ)

This product is a Nkd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Nkd1 gene may activate a second Wnt signaling pathway that controls planar cell polarity. The expression of Nkd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Nkd1-shRNA-Seq1
Related Target/Protein Nkd1
Region CDS
TargetSeq CACCATTACCACCACTTCTAT
NCBI RefSeq NM_027280
Alternative Names Naked1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 85407
Uniprot ID Q969G9

Related Products