shRNA Lentivirus (self-inactivating), p7SK-(CEP76-shRNA-Seq1)(CAT#: LV-SI1239WQ)
This product is a CEP76-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CEP76 gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. The expression of CEP76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CEP76-shRNA-Seq1 |
Related Target/Protein | CEP76 |
Region | CDS |
TargetSeq | CACATTTAAAGGGTTCCCAAT |
NCBI RefSeq | NM_024899 |
Alternative Names | C18orf9; HsT1705 |
Titer | >1*10^10 GC/mL |
Related Diseases | Centriole reduplication |