shRNA Lentivirus (self-inactivating), pU6-(FAM45B-shRNA-Seq1)(CAT#: LV-SI2193WQ)

This product is a FAM45B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of FAM45B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FAM45B-shRNA-Seq1
Related Target/Protein FAM45B
Region 3UTR
TargetSeq CGAAGTGCTATAACTACTTTA
NCBI RefSeq NM_018472
Alternative Names HT011; DENND10P1; FAM45BP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55855
Uniprot ID Q6NSW5

Related Products