shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(5730590G19Rik-shRNA-Seq1)(CAT#: AdV-SI4000WQ)

Datasheet

This product is a 5730590G19Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 5730590G19Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 5730590G19Rik-shRNA-Seq1
Related Target/Protein 5730590G19Rik
Region CDS
TargetSeq CCAAAGAAGCTGAATTTCAAA
NCBI RefSeq NM_029835
Alternative Names Lrrk1; BC028450; Ticrr
Titer >1*10^10 GC/mL
Target Gene
Gene ID 77011
Uniprot ID Q8C6J3

Related Products

Recombinant adenovirus, pU6-(Mouse Tlr9), Overexpression (CAT#:AdV-GTOH0685WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C1qtnf3-shRNA-Seq1) (CAT#:AdV-SI2721WQ) Recombinant adenovirus, pU6-(Human ELF3), Overexpression (CAT#:AdV-GTOH0337WQ) Recombinant adenovirus, pU6-(Mouse PAWR), Overexpression (CAT#:AdV-GTOH0394WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Olfr750-shRNA-Seq2) (CAT#:AdV-SI3756WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(OR8I2-shRNA-Seq1) (CAT#:AdV-SI3396WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR8D4-shRNA-Seq1) (CAT#:AdV-SI1592WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LOC80154-shRNA-Seq1) (CAT#:AdV-SI0751WQ)