shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KIAA0495-shRNA-Seq2)(CAT#: AdV-SI1428WQ)

Datasheet

This product is a KIAA0495-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of KIAA0495-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KIAA0495-shRNA-Seq2
Related Target/Protein KIAA0495
Region CDS
TargetSeq GCTTTCCAAGTAAAGATACCA
NCBI RefSeq NM_207306
Alternative Names PDAM; TP73-AS1
Titer >1*10^10 GC/mL
Related Diseases Oligodendroglial tumors
Target Gene
Gene ID 57212
Uniprot ID A0A024R4G0

Related Products

shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(9130011J15Rik-shRNA-Seq3) (CAT#:AdV-SI1717WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR5B17-shRNA-Seq1) (CAT#:AdV-SI2156WQ) Recombinant adenovirus, pU6-(Human hNRF2β1), Overexpression (CAT#:AdV-GTOH0334WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Olfr559-shRNA-Seq4) (CAT#:AdV-SI2022WQ) Recombinant adenovirus, pU6-(Mouse GABA A receptor delta subunit), Overexpression (CAT#:AdV-GTOH0585WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Cyhr1-shRNA-Seq1) (CAT#:AdV-SI4048WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR5B17-shRNA-Seq4) (CAT#:AdV-SI2159WQ) Recombinant adenovirus, pU6-(Human KMT2E), Overexpression (CAT#:AdV-GTOH0785WQ)