shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Lamtor2-shRNA-Seq1)(CAT#: AdV-SI4046WQ)
This product is a Lamtor2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Lamtor2 gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The expression of Lamtor2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Lamtor2-shRNA-Seq1 |
| Related Target/Protein | Lamtor2 |
| Region | CDS |
| TargetSeq | GCTGAATAATGAGGGATCGCT |
| NCBI RefSeq | NM_031248 |
| Alternative Names | p14; ENDAP; ROBLD3; HSPC003; MAPBPIP; MAPKSP1AP; Ragulator2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Primary immunodeficiency syndrome |
