shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Svs3a-shRNA-Seq1)(CAT#: AdV-SI3951WQ)
This product is a Svs3a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Svs3a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Svs3a-shRNA-Seq1 |
| Related Target/Protein | Svs3a |
| Region | CDS |
| TargetSeq | GAAGACATAGTTTGTGAAGAA |
| NCBI RefSeq | NM_021363 |
| Alternative Names | Svp3; Svs3; Semg2; Svp-3; BB121242; 9530026M05Rik |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |
