shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Zfp414-shRNA-Seq1)(CAT#: AdV-SI3931WQ)
This product is a Zfp414-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Zfp414 gene may be involved in transcriptional regulation. The expression of Zfp414-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Zfp414-shRNA-Seq1 |
| Related Target/Protein | Zfp414 |
| Region | CDS |
| TargetSeq | GTTCGTGATCTAGCACAGCAT |
| NCBI RefSeq | NM_026712 |
| Alternative Names | Znf414; 0610030H11Rik |
| Titer | >1*10^10 GC/mL |
