shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(ZNF714-shRNA-Seq2)(CAT#: AdV-SI1351WQ)
This product is a ZNF714-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The ZNF714 gene may be involved in transcriptional regulation. The expression of ZNF714-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | ZNF714-shRNA-Seq2 |
| Related Target/Protein | ZNF714 |
| Region | 3UTR |
| TargetSeq | CCCTCAATTCTTAACAGACAT |
| NCBI RefSeq | NM_182515 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Type 1 diabetes |
