shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(FAM124A-shRNA-Seq1)(CAT#: AdV-SI0786WQ)
This product is a FAM124A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. FAM124A belongs to the FAM124 family. The expression of FAM124A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | FAM124A-shRNA-Seq1 |
| Related Target/Protein | FAM124A |
| Region | CDS |
| TargetSeq | GTGCATAAGAAGTTTCCTAAA |
| NCBI RefSeq | NM_145019 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mycoplasma pneumoniae pneumonia |
