shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Med18-shRNA-Seq4)(CAT#: AdV-SI2731WQ)
This product is a Med18-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Med18 gene is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II. The expression of Med18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Med18-shRNA-Seq4 |
Related Target/Protein | Med18 |
Region | CDS |
TargetSeq | GCACCATTAACATGATGGAGT |
NCBI RefSeq | NM_026039 |
Alternative Names | SRB5; p28b |
Titer | >1*10^10 GC/mL |