shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(N4bp2-shRNA-Seq3)(CAT#: AdV-SI2775WQ)
This product is a N4bp2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by N4bp2 gene binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. The expression of N4bp2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | N4bp2-shRNA-Seq3 |
Related Target/Protein | N4bp2 |
Region | CDS |
TargetSeq | CCACCTTTATGAACTCAGATT |
NCBI RefSeq | NM_001024917 |
Alternative Names | B3BP |
Titer | >1*10^10 GC/mL |
Related Diseases | B-cell leukemia/lymphoma |