shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Nudcd1-shRNA-Seq6)(CAT#: AdV-SI2704WQ)
This product is a Nudcd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Nudcd1 gene may be a suitable target for antigen-specific immunotherapy. The expression of Nudcd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Nudcd1-shRNA-Seq6 |
| Related Target/Protein | Nudcd1 |
| Region | 3UTR |
| TargetSeq | GCTACGTCTAAACAGACAGTA |
| NCBI RefSeq | NM_026149 |
| Alternative Names | CML66; OVA66 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Solid tumors |
