shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Pus7-shRNA-Seq5)(CAT#: AdV-SI2637WQ)
This product is a Pus7-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Pus7 gene encodes pseudouridylate synthase that catalyzes pseudouridylation of RNAs. The expression of Pus7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Pus7-shRNA-Seq5 |
| Related Target/Protein | Pus7 |
| Region | CDS |
| TargetSeq | CCCACCTACATTGAGGAAGAT |
| NCBI RefSeq | NM_178403 |
| Alternative Names | IDDABS |
| Titer | >1*10^10 GC/mL |
