shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SCAF1-shRNA-Seq2)(CAT#: AdV-SI0780WQ)
This product is a SCAF1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SCAF1 may function in pre-mRNA splicing. The expression of SCAF1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SCAF1-shRNA-Seq2 |
| Related Target/Protein | SCAF1 |
| Region | 3UTR |
| TargetSeq | CCCTCACCTCTTTGAAACTCT |
| NCBI RefSeq | NM_021228 |
| Alternative Names | SRA1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Atherosclerosis |
