shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(ZDHHC3-shRNA-Seq3)(CAT#: AdV-SI0970WQ)

This product is a ZDHHC3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. ZDHHC3 Tyrosine Phosphorylation Regulates Neural Cell Adhesion Molecule Palmitoylation. The expression of ZDHHC3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert ZDHHC3-shRNA-Seq3
Related Target/Protein ZDHHC3
Region CDS
TargetSeq GTGGATGAACATGAAAGCCGT
NCBI RefSeq NM_016598
Alternative Names GODZ; DHHC3; DHHC-3; ZNF373
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 51304
Uniprot ID Q9NYG2

Related Products

Advertisement