shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(ANKRD20A1-shRNA-Seq2)(CAT#: AdV-SI0201WQ)

Datasheet

This product is a ANKRD20A1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of ANKRD20A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert ANKRD20A1-shRNA-Seq2
Related Target/Protein ANKRD20A1
Region CDS
TargetSeq CAAGTTCACATGCCGTTGATA
NCBI RefSeq NM_032250
Alternative Names ANKRD20A
Titer >1*10^10 GC/mL
Related Diseases Behçet's disease
Target Gene
Gene ID 84210
Uniprot ID Q5TYW2

Related Products

shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SF3B4-shRNA-Seq4) (CAT#:AdV-SI0042WQ) Recombinant adenovirus, pU6-(Domestic silkworm Br-c_Z4 3'UTR), Overexpression (CAT#:AdV-GTOH0624WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SPATA19-shRNA-Seq2) (CAT#:AdV-SI0165WQ) Recombinant adenovirus, pU6-(Human hsa-mir-29a), Overexpression (CAT#:AdV-GTOH0326WQ) Recombinant adenovirus, pU6-(Human GNAT1), Overexpression (CAT#:AdV-GTOH0125WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Csrnp1-shRNA-Seq3) (CAT#:AdV-SI1766WQ) Recombinant adenovirus, pU6-(Human SCARB1 3'UTR), Overexpression (CAT#:AdV-GTOH0633WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Atxn7l1-shRNA-Seq1) (CAT#:AdV-SI2706WQ)