shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C20orf43-shRNA-Seq2)(CAT#: AdV-SI0360WQ)
This product is a C20orf43-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C20orf43 gene is required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication. The expression of C20orf43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C20orf43-shRNA-Seq2 |
| Related Target/Protein | C20orf43 |
| Region | CDS |
| TargetSeq | CCTGTGAACTTGGCAGACTTT |
| NCBI RefSeq | NM_016407 |
| Alternative Names | CDAO5; RTFDC1; HSPC164; RTF2; SHUJUN-3 |
| Titer | >1*10^10 GC/mL |
