shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C4orf37-shRNA-Seq2)(CAT#: AdV-SI0333WQ)
This product is a C4orf37-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C4orf37 gene may be associated with male factor infertility. The expression of C4orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C4orf37-shRNA-Seq2 |
| Related Target/Protein | C4orf37 |
| Region | 3UTR |
| TargetSeq | CGCTCAGGCTTTAGTGACTAT |
| NCBI RefSeq | NM_174952 |
| Alternative Names | STPG2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |
