shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(CRAMP1L-shRNA-Seq2)(CAT#: AdV-SI0381WQ)
This product is a CRAMP1L-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of CRAMP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CRAMP1L-shRNA-Seq2 |
| Related Target/Protein | CRAMP1L |
| Region | CDS |
| TargetSeq | CCATCAGTATGCAGTCGGATT |
| NCBI RefSeq | NM_020825 |
| Alternative Names | HN1L; TCE4; CRAMP1L |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lamotrigine (LTG)-induced maculopapular eruption (MPE) |
