shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Ctu2-shRNA-Seq5)(CAT#: AdV-SI1792WQ)
This product is a Ctu2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Ctu2 gene a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs) and plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. The expression of Ctu2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Ctu2-shRNA-Seq5 |
Related Target/Protein | Ctu2 |
Region | CDS |
TargetSeq | CCAGGAGTCATCTATGTTGAT |
NCBI RefSeq | NM_153775 |
Alternative Names | MFRG; NCS2; UPF0432; C16orf84 |
Titer | >1*10^10 GC/mL |