shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(DDX10-shRNA-Seq1)(CAT#: AdV-SI0147WQ)
This product is a DDX10-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. DDX10 gene is implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. The expression of DDX10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | DDX10-shRNA-Seq1 |
Related Target/Protein | DDX10 |
Region | CDS |
TargetSeq | CCAGTGCTGGAAGCCTTATAT |
NCBI RefSeq | NM_004398 |
Alternative Names | Dbp4; HRH-J8 |
Titer | >1*10^10 GC/mL |
Related Diseases | Myeloid malignancies |